Review



tlcv2 loxp backbone  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc tlcv2 loxp backbone

    Tlcv2 Loxp Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tlcv2+loxp+backbone/TLCV2-LoxP+(Plasmid+%23127098)/pmc11982489-403-26-35
    Average 93 stars, based on 4 article reviews
    tlcv2 loxp backbone - by Bioz Stars, 2026-09
    93/100 stars

    Images

    1) Product Images from "Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment"

    Article Title: Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment

    Journal: iScience

    doi: 10.1016/j.isci.2025.112198


    Figure Legend Snippet:

    Techniques Used: Virus, Generated, Recombinant, Membrane, Electron Microscopy, Saline, Enzyme-linked Immunosorbent Assay, Bicinchoninic Acid Protein Assay, Western Blot, RNA Sequencing, Gene Expression, Imaging, Plasmid Preparation, shRNA, Control, Luciferase, Cloning, Expressing, Software, Cell Analysis, Microscopy, Cell Culture

    Related Articles

    Sequencing:

    Article Title: Versatile roles of Annexin A4 in ccRCC: impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment
    Article Snippet: .. Guide sequences (non targeting – nt-sgRNA-1: 5’-GCGGGCAGAACGACCCTGAC -3’, nt-sgRNA-2: 5’-GAAGACGTGCTGGCGTCACC -3’; ANXA4-targeting – ANXA4-sg1: TCTGCTGGCTATAGGTAAGC(TGG), ANXA4-sg2: GGACGATGCTCTCGTGAGAC(AGG) – PAM sequence in brackets) were cloned into TLCV2-LoxP backbone (TLCV2-LoxP was a gift from Adam Karpf (Addgene plasmid #127098; http://n2t.net/addgene:127098 ; RRID:Addgene_127098) and respective constructs transformed into competent E.coli (C3040H, New England Biolabs, Ispwich, USA) miniprepped and Sanger sequenced using hU6-F primer (5’-GAGGGCCTATTTCCCATGATT-3’). ..

    Article Title: Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment
    Article Snippet: .. Guide sequences (non-targeting – nt-sgRNA-1: 5′- GCGGGCAGAACGACCCTGAC -3', nt-sgRNA-2: 5′- GAAGACGTGCTGGCGTCACC -3'; ANXA4-targeting – ANXA4-sg1: TCTGCTGGCTATAGGTAAGC(TGG), ANXA4-sg2: GGACGATGCTCTCGTGAGAC(AGG) - (PAM sequence in brackets)) were cloned into TLCV2-LoxP backbone (TLCV2-LoxP was a gift from Adam Karpf (Addgene plasmid #127098; http://n2t.net/addgene:127098; RRID:Addgene_127098). .. Respective constructs were transformed into competent E.coli (C3040H, New England Biolabs, Ispwich, USA), miniprepped and Sanger sequenced using hU6-F primer (5′-GAGGGCCTATTTCCCATGATT-3′).

    Clone Assay:

    Article Title: Versatile roles of Annexin A4 in ccRCC: impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment
    Article Snippet: .. Guide sequences (non targeting – nt-sgRNA-1: 5’-GCGGGCAGAACGACCCTGAC -3’, nt-sgRNA-2: 5’-GAAGACGTGCTGGCGTCACC -3’; ANXA4-targeting – ANXA4-sg1: TCTGCTGGCTATAGGTAAGC(TGG), ANXA4-sg2: GGACGATGCTCTCGTGAGAC(AGG) – PAM sequence in brackets) were cloned into TLCV2-LoxP backbone (TLCV2-LoxP was a gift from Adam Karpf (Addgene plasmid #127098; http://n2t.net/addgene:127098 ; RRID:Addgene_127098) and respective constructs transformed into competent E.coli (C3040H, New England Biolabs, Ispwich, USA) miniprepped and Sanger sequenced using hU6-F primer (5’-GAGGGCCTATTTCCCATGATT-3’). ..

    Article Title: Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment
    Article Snippet: .. Guide sequences (non-targeting – nt-sgRNA-1: 5′- GCGGGCAGAACGACCCTGAC -3', nt-sgRNA-2: 5′- GAAGACGTGCTGGCGTCACC -3'; ANXA4-targeting – ANXA4-sg1: TCTGCTGGCTATAGGTAAGC(TGG), ANXA4-sg2: GGACGATGCTCTCGTGAGAC(AGG) - (PAM sequence in brackets)) were cloned into TLCV2-LoxP backbone (TLCV2-LoxP was a gift from Adam Karpf (Addgene plasmid #127098; http://n2t.net/addgene:127098; RRID:Addgene_127098). .. Respective constructs were transformed into competent E.coli (C3040H, New England Biolabs, Ispwich, USA), miniprepped and Sanger sequenced using hU6-F primer (5′-GAGGGCCTATTTCCCATGATT-3′).

    Plasmid Preparation:

    Article Title: Versatile roles of Annexin A4 in ccRCC: impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment
    Article Snippet: .. Guide sequences (non targeting – nt-sgRNA-1: 5’-GCGGGCAGAACGACCCTGAC -3’, nt-sgRNA-2: 5’-GAAGACGTGCTGGCGTCACC -3’; ANXA4-targeting – ANXA4-sg1: TCTGCTGGCTATAGGTAAGC(TGG), ANXA4-sg2: GGACGATGCTCTCGTGAGAC(AGG) – PAM sequence in brackets) were cloned into TLCV2-LoxP backbone (TLCV2-LoxP was a gift from Adam Karpf (Addgene plasmid #127098; http://n2t.net/addgene:127098 ; RRID:Addgene_127098) and respective constructs transformed into competent E.coli (C3040H, New England Biolabs, Ispwich, USA) miniprepped and Sanger sequenced using hU6-F primer (5’-GAGGGCCTATTTCCCATGATT-3’). ..

    Article Title: Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment
    Article Snippet: .. Guide sequences (non-targeting – nt-sgRNA-1: 5′- GCGGGCAGAACGACCCTGAC -3', nt-sgRNA-2: 5′- GAAGACGTGCTGGCGTCACC -3'; ANXA4-targeting – ANXA4-sg1: TCTGCTGGCTATAGGTAAGC(TGG), ANXA4-sg2: GGACGATGCTCTCGTGAGAC(AGG) - (PAM sequence in brackets)) were cloned into TLCV2-LoxP backbone (TLCV2-LoxP was a gift from Adam Karpf (Addgene plasmid #127098; http://n2t.net/addgene:127098; RRID:Addgene_127098). .. Respective constructs were transformed into competent E.coli (C3040H, New England Biolabs, Ispwich, USA), miniprepped and Sanger sequenced using hU6-F primer (5′-GAGGGCCTATTTCCCATGATT-3′).

    Construct:

    Article Title: Versatile roles of Annexin A4 in ccRCC: impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment
    Article Snippet: .. Guide sequences (non targeting – nt-sgRNA-1: 5’-GCGGGCAGAACGACCCTGAC -3’, nt-sgRNA-2: 5’-GAAGACGTGCTGGCGTCACC -3’; ANXA4-targeting – ANXA4-sg1: TCTGCTGGCTATAGGTAAGC(TGG), ANXA4-sg2: GGACGATGCTCTCGTGAGAC(AGG) – PAM sequence in brackets) were cloned into TLCV2-LoxP backbone (TLCV2-LoxP was a gift from Adam Karpf (Addgene plasmid #127098; http://n2t.net/addgene:127098 ; RRID:Addgene_127098) and respective constructs transformed into competent E.coli (C3040H, New England Biolabs, Ispwich, USA) miniprepped and Sanger sequenced using hU6-F primer (5’-GAGGGCCTATTTCCCATGATT-3’). ..

    Transformation Assay:

    Article Title: Versatile roles of Annexin A4 in ccRCC: impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment
    Article Snippet: .. Guide sequences (non targeting – nt-sgRNA-1: 5’-GCGGGCAGAACGACCCTGAC -3’, nt-sgRNA-2: 5’-GAAGACGTGCTGGCGTCACC -3’; ANXA4-targeting – ANXA4-sg1: TCTGCTGGCTATAGGTAAGC(TGG), ANXA4-sg2: GGACGATGCTCTCGTGAGAC(AGG) – PAM sequence in brackets) were cloned into TLCV2-LoxP backbone (TLCV2-LoxP was a gift from Adam Karpf (Addgene plasmid #127098; http://n2t.net/addgene:127098 ; RRID:Addgene_127098) and respective constructs transformed into competent E.coli (C3040H, New England Biolabs, Ispwich, USA) miniprepped and Sanger sequenced using hU6-F primer (5’-GAGGGCCTATTTCCCATGATT-3’). ..



    Similar Products

    tlcv2 loxp backbone  (Addgene inc)
    93
    Addgene inc tlcv2 loxp backbone

    Tlcv2 Loxp Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tlcv2+loxp+backbone/TLCV2-LoxP+(Plasmid+%23127098)/pmc11982489-403-26-35
    Average 93 stars, based on 1 article reviews
    tlcv2 loxp backbone - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment

    doi: 10.1016/j.isci.2025.112198

    Figure Lengend Snippet:

    Article Snippet: Guide sequences (non-targeting – nt-sgRNA-1: 5′- GCGGGCAGAACGACCCTGAC -3', nt-sgRNA-2: 5′- GAAGACGTGCTGGCGTCACC -3'; ANXA4-targeting – ANXA4-sg1: TCTGCTGGCTATAGGTAAGC(TGG), ANXA4-sg2: GGACGATGCTCTCGTGAGAC(AGG) - (PAM sequence in brackets)) were cloned into TLCV2-LoxP backbone (TLCV2-LoxP was a gift from Adam Karpf (Addgene plasmid #127098; http://n2t.net/addgene:127098; RRID:Addgene_127098).

    Techniques: Virus, Generated, Recombinant, Membrane, Electron Microscopy, Saline, Enzyme-linked Immunosorbent Assay, Bicinchoninic Acid Protein Assay, Western Blot, RNA Sequencing, Gene Expression, Imaging, Plasmid Preparation, shRNA, Control, Luciferase, Cloning, Expressing, Software, Cell Analysis, Microscopy, Cell Culture